NLRP3 Human shRNA Lentivirus

The NLRP3 shRNA Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain 3 shRNAs (Short hairpin RNA) targeting human NLRP3 driven by a U6 promoter, and a puromycin selection marker (Figures 1) . The sequences of the shRNA used are shown in Table 1.Figure 1. Schematic of the lenti-vector used to generate the NLRP3 Human shRNA Lentivirus.Table 1: List of shRNA sequences present in the NLRP3 shRNA Lentivirus.Gene TargetshRNA SequenceNLRP3GAGACTCAGGAGTCGCAATTTNLRP3GGCTGTAACATTCGGAGATTGNLRP3TCATCATTCCCGCTATCTTTC